A small tool to view real-world ActivityPub objects as JSON! Enter a URL
or username from Mastodon or a similar service below, and we'll send a
request with
the right
Accept
header
to the server to view the underlying object.
{
"@context": "https://www.w3.org/ns/activitystreams",
"type": "OrderedCollectionPage",
"orderedItems": [
{
"type": "Announce",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/458478272561291264/entities/urn:activity:1296439294512074757",
"attributedTo": "https://www.minds.com/api/activitypub/users/458478272561291264",
"content": "<a href=\"https://www.minds.com/newsfeed/1296439294512074757\" target=\"_blank\">https://www.minds.com/newsfeed/1296439294512074757</a>",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/458478272561291264/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1296439294512074757",
"published": "2021-10-17T11:46:53+00:00",
"source": {
"content": "https://www.minds.com/newsfeed/1296439294512074757",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1296467266526777364/activity",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/458478272561291264",
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
]
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1286505164642979856",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "Well done piece by Jimmy Dore about Vaccine Mandates. This insanity needs to stop!<br /><br /><br /><a href=\"https://www.youtube.com/watch?v=kq1WuFuglz0\" target=\"_blank\">https://www.youtube.com/watch?v=kq1WuFuglz0</a>",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1286505164642979856",
"published": "2021-09-20T01:52:12+00:00",
"source": {
"content": "Well done piece by Jimmy Dore about Vaccine Mandates. This insanity needs to stop!\n\n\nhttps://www.youtube.com/watch?v=kq1WuFuglz0",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1286505164642979856/activity"
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1254656263940435968",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "<a class=\"u-url mention\" href=\"https://www.minds.com/ottman\" target=\"_blank\">@ottman</a> <br /><br />BIll -- user <a class=\"u-url mention\" href=\"https://www.minds.com/joycebowen\" target=\"_blank\">@joycebowen</a> is boosting misinformation regarding vaccines changing an individual's DNA. When I pointed out the flaws in her reasoning she deleted my response and blocked me. I'm right - but who knows I can be wrong - debate should happen. Your website has a huge flaw if boosted content goes unchallenged.<br /><br />Simple rule - you boost - your post becomes an open forum. <br /><br />Make it happen <a class=\"u-url mention\" href=\"https://www.minds.com/ottman\" target=\"_blank\">@ottman</a> !!<br /><br />***Update -- After some good discussions I can understand the need to block -- but just so you know <a class=\"u-url mention\" href=\"https://www.minds.com/joycebowen\" target=\"_blank\">@joycebowen</a> - boost complete nonsense again and I'm boosting right back at ya!",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/100000000000000000",
"name": "@ottman"
},
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/1151617319491870727",
"name": "@joycebowen"
},
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/100000000000000000",
"name": "@ottman"
},
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/1151617319491870727",
"name": "@joycebowen"
}
],
"url": "https://www.minds.com/newsfeed/1254656263940435968",
"published": "2021-06-24T04:36:03+00:00",
"source": {
"content": "@ottman \n\nBIll -- user @joycebowen is boosting misinformation regarding vaccines changing an individual's DNA. When I pointed out the flaws in her reasoning she deleted my response and blocked me. I'm right - but who knows I can be wrong - debate should happen. Your website has a huge flaw if boosted content goes unchallenged.\n\nSimple rule - you boost - your post becomes an open forum. \n\nMake it happen @ottman !!\n\n***Update -- After some good discussions I can understand the need to block -- but just so you know @joycebowen - boost complete nonsense again and I'm boosting right back at ya!",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1254656263940435968/activity"
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1249829055110955008",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "In my previous post discussing why people aren't getting the vaccine there was one clear reason that stood above all others - safety. It is a reasonable concern to want unbiased safety data for anything we would inject into our bodies. To explore this I have been begun scavenging any data on this topic - however, before I get to my findings, I will first write this post to better define the topic. <br /><br />Many people will refer to \"the vaccine\" suggesting a singular entity exists - but the reality is (as seen in the attached picture) that already there are multiple vaccines from different manufacturers available, and each with different strategies to provide protection against COVID-19. At present there are 5 commonly being used (Pfizer, Moderna, J&J-AstraZeneca, Russian based Sputnik, and a Chinese vaccine called Sinovak) and already there are 25 vaccines presently in phase III clinical trials followed by 72 others in PHASE I and II trials. <br /><br />So the question of safety will vary between each - especially since different technologies are at play.<br /><br />The newest technology is messageRNA (mRNA) technology - this version places a messenger RNA in a lipid capsule that is taken up by immune cells. These cells use the message to generate the COVID-19 Spike protein within those cells - which then trains to immune system to target the COVID virus. mRNA technology has never been used for clinical use, hence the reasonable concern. The Pfizer and Moderna vaccines use this strategy.<br /><br />The next newest technology co-opts the cold virus (adenovirus) - DNA encoding the COVID spike protein is placed within the adenovirus. These viruses are then taken up by immune cells and will use cell machinery to generate mRNA and then spike proteins that train the immune system to target the COVID virus. This technology has been used for newer vaccines like the Ebola virus vaccine - presently the J&J-Astrazenca vaccine and the Russian Sputnik use this strategy.<br /><br />Another strategy still in the pipeline is to produce the viral proteins in the lab and use that as the vaccine.<br /><br />Finally, the more traditional method of using killed/inactivated COVID-19 virus is also being used. The Chinese vaccine SinoVak uses this strategy. <br /><br />The rapidly growing selection of vaccines (~200 counting everything in the pipeline?) signals to me that this is the marketplace responding to demand, as opposed to some sinister plot of release the disease and sell the cure - or worse, the scenario of \"the vaccine\" that is designed to eliminate the masses. Feel free to debate that below.<br /><br />The big question is whether all this is safe? The post will be next.<br />",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1249829055110955008",
"published": "2021-06-10T20:54:26+00:00",
"source": {
"content": "In my previous post discussing why people aren't getting the vaccine there was one clear reason that stood above all others - safety. It is a reasonable concern to want unbiased safety data for anything we would inject into our bodies. To explore this I have been begun scavenging any data on this topic - however, before I get to my findings, I will first write this post to better define the topic. \n\nMany people will refer to \"the vaccine\" suggesting a singular entity exists - but the reality is (as seen in the attached picture) that already there are multiple vaccines from different manufacturers available, and each with different strategies to provide protection against COVID-19. At present there are 5 commonly being used (Pfizer, Moderna, J&J-AstraZeneca, Russian based Sputnik, and a Chinese vaccine called Sinovak) and already there are 25 vaccines presently in phase III clinical trials followed by 72 others in PHASE I and II trials. \n\nSo the question of safety will vary between each - especially since different technologies are at play.\n\nThe newest technology is messageRNA (mRNA) technology - this version places a messenger RNA in a lipid capsule that is taken up by immune cells. These cells use the message to generate the COVID-19 Spike protein within those cells - which then trains to immune system to target the COVID virus. mRNA technology has never been used for clinical use, hence the reasonable concern. The Pfizer and Moderna vaccines use this strategy.\n\nThe next newest technology co-opts the cold virus (adenovirus) - DNA encoding the COVID spike protein is placed within the adenovirus. These viruses are then taken up by immune cells and will use cell machinery to generate mRNA and then spike proteins that train the immune system to target the COVID virus. This technology has been used for newer vaccines like the Ebola virus vaccine - presently the J&J-Astrazenca vaccine and the Russian Sputnik use this strategy.\n\nAnother strategy still in the pipeline is to produce the viral proteins in the lab and use that as the vaccine.\n\nFinally, the more traditional method of using killed/inactivated COVID-19 virus is also being used. The Chinese vaccine SinoVak uses this strategy. \n\nThe rapidly growing selection of vaccines (~200 counting everything in the pipeline?) signals to me that this is the marketplace responding to demand, as opposed to some sinister plot of release the disease and sell the cure - or worse, the scenario of \"the vaccine\" that is designed to eliminate the masses. Feel free to debate that below.\n\nThe big question is whether all this is safe? The post will be next.\n",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1249829055110955008/activity"
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1241220470941675520",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "Polymerase chain reaction (PCR) is a method to copy a target nucleic acid sequence. By coupling the process the fluorescent reporters - it is used to diagnose the presence of diseases like COVID-19. Here is how it works:<br /><br />PCR starts with the creation of small DNA sequences (about 18-25 base pairs) called \"PRIMERS\" - two of them are used (forward and backward) that sit on opposite sides of the region of the genome you want to copy. To start the program you add the source of your DNA (I.e., the dreaded nasal swab), the primers, and a mixture that contains a DNA polymerase and single DNA nucleotides. All is loaded into a PCR machine that begins to run \"CYCLES\", typically<br /><br />1) Heat to 95 degrees Celsius - causes all DNA to become single stranded, which allows primers some place to bind<br />2) Cool to ~50-70 degrees C - allows the primer to bind to the specific region of interest<br />3) Bring to 72C - the temperature that the polymerase binds to the section that the primer is bound to the DNA source - and begins extending from that point forward<br /><br />After about 3-5 CYCLES the mixture will begin to be dominated by the PCR product - the nucleotides ranging from the forward primer, the region in the middle, to the reverse primer. For a PCR test - a fluorescent dye is added that only lights up when double stranded DNA is present -- as the PCR process progresses - the amount of double stranded DNA increases - allowing the \"positive\" if the peak is there, or \"negative\" if the peak is not there.<br /><br />*******HOW IS THIS USED FOR COVID-19?********<br />COVID-19 is a genome with 29,715 base pairs. The COVID-19 test has two primer sets:<br />Primer Set 1<br />>Forward<br />GAC CCC AAA ATC AGC GAA AT<br />>Reverse<br />TCT GGT TAC TGC CAG TTG AAT CTG<br />>>>Recognizes 72 base pairs from base pair #28155 --> 28226 <br /><br />Primer Set 2<br />>Forward<br />TTA CAA ACA TTG GCC GCA AA<br />>Reverse<br />GCG CGA CAT TCC GAA GAA<br />>>>> Recognizes 67 base pairs from base pair #29032 --> 29098<br /><br />*Note for the detail folks out there -- COVID-19 is a RNA virus - so before PCR takes place a initial step is performed to convert the RNA to DNA.<br /><br />******HOW DO WE KNOW IT IS TRULY AMPLIFYING COVID-19****<br />Is PCR perfect? Not at all - But its amazingly good. Those that question the ability to use PCR to detect COVID will have one of two concerns.<br /><br />Concern #1- \"PCR is not a tool to detect COVID - especially with going up to 40-50 cycles\"<br /><br />What this refers to is that the primer does not necessarily have to match perfectly to the DNA source or even sometime the primers will bind to themselves and cause themselves to amplify. This is called a non-specific product. Sometimes, but not always, increasing the number of cycles will increase the chances of seeing these non-specific products. So how do we know its truly COVID-19 we've amplified? <br />3 reasons: First, the amplified product should be an exact base pair size - for instance - primer set 1, the product should be exactly 72 base pairs -- this can be confirmed with a technique called gel electrophoresis or with mass spectroscopy. Second, two primer sets are used - So the chances that two non-specific products of the correct size forming is crazy low! Both amplifications must be positive to have a positive result. Third - you can take the PCR products and have the sequence to tell you the exact product you have - this should then match the COVID-19 genome.<br /><br />Concern #2 - \"What if PCR detects another virus like the common cold, which is also a corona virus?\"<br /><br />In order for a PCR product to form, there has to be a pretty close match of sequence for both forward and reverse primers - and the location on the DNA source must be close -- so even if you have good matches for forward on Chromosome 1 and reverse on chromosome 10 the PCR will fail.<br /><br />Aside from that - we can even check the expected DNA PCR product against the genomes of every sequenced organism using a tool called NCBI blast (<a href=\"https://www.ebi.ac.uk/Tools/sss/ncbiblast/\" target=\"_blank\">https://www.ebi.ac.uk/Tools/sss/ncbiblast/</a>). The image for this post shows my result from \"blasting\" the COVID Primer set 1 product, \"gaccccaaaatcagcgaaatgcaccccgcattacgtttggtggaccctcagattcaactggcagtaaccaga\" These results show that the alignment was dead on for COVID-19 (AKA SARS2) -- which is expected -- with less similarity was the corona bat viruses - the similarity quickly falls off - and notably missing are common cold corona viruses. This suggest the primers we are using WILL NOT detect common cold corona viruses.<br /><br />Alot here - thanks for reading if you got this far! I will be happy to address further concerns or questions",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1241220470941675520",
"published": "2021-05-18T02:46:59+00:00",
"source": {
"content": "Polymerase chain reaction (PCR) is a method to copy a target nucleic acid sequence. By coupling the process the fluorescent reporters - it is used to diagnose the presence of diseases like COVID-19. Here is how it works:\n\nPCR starts with the creation of small DNA sequences (about 18-25 base pairs) called \"PRIMERS\" - two of them are used (forward and backward) that sit on opposite sides of the region of the genome you want to copy. To start the program you add the source of your DNA (I.e., the dreaded nasal swab), the primers, and a mixture that contains a DNA polymerase and single DNA nucleotides. All is loaded into a PCR machine that begins to run \"CYCLES\", typically\n\n1) Heat to 95 degrees Celsius - causes all DNA to become single stranded, which allows primers some place to bind\n2) Cool to ~50-70 degrees C - allows the primer to bind to the specific region of interest\n3) Bring to 72C - the temperature that the polymerase binds to the section that the primer is bound to the DNA source - and begins extending from that point forward\n\nAfter about 3-5 CYCLES the mixture will begin to be dominated by the PCR product - the nucleotides ranging from the forward primer, the region in the middle, to the reverse primer. For a PCR test - a fluorescent dye is added that only lights up when double stranded DNA is present -- as the PCR process progresses - the amount of double stranded DNA increases - allowing the \"positive\" if the peak is there, or \"negative\" if the peak is not there.\n\n*******HOW IS THIS USED FOR COVID-19?********\nCOVID-19 is a genome with 29,715 base pairs. The COVID-19 test has two primer sets:\nPrimer Set 1\n>Forward\nGAC CCC AAA ATC AGC GAA AT\n>Reverse\nTCT GGT TAC TGC CAG TTG AAT CTG\n>>>Recognizes 72 base pairs from base pair #28155 --> 28226 \n\nPrimer Set 2\n>Forward\nTTA CAA ACA TTG GCC GCA AA\n>Reverse\nGCG CGA CAT TCC GAA GAA\n>>>> Recognizes 67 base pairs from base pair #29032 --> 29098\n\n*Note for the detail folks out there -- COVID-19 is a RNA virus - so before PCR takes place a initial step is performed to convert the RNA to DNA.\n\n******HOW DO WE KNOW IT IS TRULY AMPLIFYING COVID-19****\nIs PCR perfect? Not at all - But its amazingly good. Those that question the ability to use PCR to detect COVID will have one of two concerns.\n\nConcern #1- \"PCR is not a tool to detect COVID - especially with going up to 40-50 cycles\"\n\nWhat this refers to is that the primer does not necessarily have to match perfectly to the DNA source or even sometime the primers will bind to themselves and cause themselves to amplify. This is called a non-specific product. Sometimes, but not always, increasing the number of cycles will increase the chances of seeing these non-specific products. So how do we know its truly COVID-19 we've amplified? \n3 reasons: First, the amplified product should be an exact base pair size - for instance - primer set 1, the product should be exactly 72 base pairs -- this can be confirmed with a technique called gel electrophoresis or with mass spectroscopy. Second, two primer sets are used - So the chances that two non-specific products of the correct size forming is crazy low! Both amplifications must be positive to have a positive result. Third - you can take the PCR products and have the sequence to tell you the exact product you have - this should then match the COVID-19 genome.\n\nConcern #2 - \"What if PCR detects another virus like the common cold, which is also a corona virus?\"\n\nIn order for a PCR product to form, there has to be a pretty close match of sequence for both forward and reverse primers - and the location on the DNA source must be close -- so even if you have good matches for forward on Chromosome 1 and reverse on chromosome 10 the PCR will fail.\n\nAside from that - we can even check the expected DNA PCR product against the genomes of every sequenced organism using a tool called NCBI blast (https://www.ebi.ac.uk/Tools/sss/ncbiblast/). The image for this post shows my result from \"blasting\" the COVID Primer set 1 product, \"gaccccaaaatcagcgaaatgcaccccgcattacgtttggtggaccctcagattcaactggcagtaaccaga\" These results show that the alignment was dead on for COVID-19 (AKA SARS2) -- which is expected -- with less similarity was the corona bat viruses - the similarity quickly falls off - and notably missing are common cold corona viruses. This suggest the primers we are using WILL NOT detect common cold corona viruses.\n\nAlot here - thanks for reading if you got this far! I will be happy to address further concerns or questions",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1241220470941675520/activity"
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1238355853662679040",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "This is an argument I've heard countless times on minds and elsewhere and It is completely wrong - but it sounds fairly badass so I don't fault anyone for using it. So why is it wrong? I will discuss the history of Kary Mullis, PCR, and this statement in this post - then talk about the science of PCR on the next post. <br /><br />Kary Mullis is the inventor of Polymerase chain reaction (PCR) a technique he devised while on ACID (LSD), which is impressive in its own right - but for his efforts he is a Nobel prize recipient - so his opinions carry weight. <br /><br />The statement quoted by so many actually was never said by Mullis as he passed away in 2019 before we became aware of COVID-19. What we have is an extrapolation of his argument, \"[PCR CAN FIND] anything in anybody ... someone with HIV generally is going to have almost anything that you can test for ... to test for that one and say that has any special meaning is what I think is the problem\", stated in a 1993 interview. <br /><br />However, this comment from Mullis needs to be put into its proper context. Mullis was an advocate of the HIV is not AIDS hypothesis, which was fairly appealing when I looked into it many years ago. Basically - the concept was that AIDS (Acquired Immunodeficiency syndrome) - the breakdown of one's immune cells - was caused by something other than the human immunodeficiency virus (HIV) -- that it was merely coincidental that those with AIDS tested positive for HIV, and actually, the destruction of the immune cells were actually more likely caused by the harsh drugs given at the time (AZT for example). <br />The rationale for this theory is that HIV was diagnosed with a PCR test, and if an individual had in their genome any sequence that in any way resembled the HIV sequence then in would show up as a false positive. Those in the HIV does not cause AIDS camp believed this was actually quite common in the population. However, the success of Anti-HIV retroviral drug therapy and the sequencing of the entire genome in 2000, reveals that HIV is pretty much the cause of AIDS and that the HIV virus does not resemble any areas of our genome. <br /><br />Bringing it back to present times, PCR has dramatically improved and is used to diagnose a wide range of diseases including Malaria, Lymes disease, Herpes, hepatitis, and more. Regarding its use for COVID - the human genome does not have sequences similar to those of the COVID Viral genome - so not likely to cause false positives for that reason. Thus, Kary Mullis's concerns are simply not applicable to today's PCR test - its out dated thinking. Additionally, following the PCR test - we can actually sequencing the products to confirm we aren't just amplifying some random target - that we are actually amplifying COVID-19 Genome products.<br /><br />I heard concerns about if common cold corona viruses may cause false positives - I'll discuss this in my next post involving the science of PCR as well as address \"over cycling\" (going to 50 cycles and beyond) - plus any other concerns people comment below. Thanks for your time! <br /><br /><a class=\"u-url mention\" href=\"https://www.minds.com/vale13\" target=\"_blank\">@vale13</a> <a class=\"u-url mention\" href=\"https://www.minds.com/martamus\" target=\"_blank\">@martamus</a> <a class=\"u-url mention\" href=\"https://www.minds.com/Derilajos\" target=\"_blank\">@Derilajos</a> <a class=\"u-url mention\" href=\"https://www.minds.com/aaron8122\" target=\"_blank\">@aaron8122</a> <a class=\"u-url mention\" href=\"https://www.minds.com/onedeadangel\" target=\"_blank\">@onedeadangel</a><br />",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/769328511352578056",
"name": "@martamus"
},
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/919660232127291398",
"name": "@Derilajos"
},
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/1196245514446708742",
"name": "@aaron8122"
},
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/1196125109669076995",
"name": "@onedeadangel"
}
],
"url": "https://www.minds.com/newsfeed/1238355853662679040",
"published": "2021-05-10T05:04:01+00:00",
"source": {
"content": "This is an argument I've heard countless times on minds and elsewhere and It is completely wrong - but it sounds fairly badass so I don't fault anyone for using it. So why is it wrong? I will discuss the history of Kary Mullis, PCR, and this statement in this post - then talk about the science of PCR on the next post. \n\nKary Mullis is the inventor of Polymerase chain reaction (PCR) a technique he devised while on ACID (LSD), which is impressive in its own right - but for his efforts he is a Nobel prize recipient - so his opinions carry weight. \n\nThe statement quoted by so many actually was never said by Mullis as he passed away in 2019 before we became aware of COVID-19. What we have is an extrapolation of his argument, \"[PCR CAN FIND] anything in anybody ... someone with HIV generally is going to have almost anything that you can test for ... to test for that one and say that has any special meaning is what I think is the problem\", stated in a 1993 interview. \n\nHowever, this comment from Mullis needs to be put into its proper context. Mullis was an advocate of the HIV is not AIDS hypothesis, which was fairly appealing when I looked into it many years ago. Basically - the concept was that AIDS (Acquired Immunodeficiency syndrome) - the breakdown of one's immune cells - was caused by something other than the human immunodeficiency virus (HIV) -- that it was merely coincidental that those with AIDS tested positive for HIV, and actually, the destruction of the immune cells were actually more likely caused by the harsh drugs given at the time (AZT for example). \nThe rationale for this theory is that HIV was diagnosed with a PCR test, and if an individual had in their genome any sequence that in any way resembled the HIV sequence then in would show up as a false positive. Those in the HIV does not cause AIDS camp believed this was actually quite common in the population. However, the success of Anti-HIV retroviral drug therapy and the sequencing of the entire genome in 2000, reveals that HIV is pretty much the cause of AIDS and that the HIV virus does not resemble any areas of our genome. \n\nBringing it back to present times, PCR has dramatically improved and is used to diagnose a wide range of diseases including Malaria, Lymes disease, Herpes, hepatitis, and more. Regarding its use for COVID - the human genome does not have sequences similar to those of the COVID Viral genome - so not likely to cause false positives for that reason. Thus, Kary Mullis's concerns are simply not applicable to today's PCR test - its out dated thinking. Additionally, following the PCR test - we can actually sequencing the products to confirm we aren't just amplifying some random target - that we are actually amplifying COVID-19 Genome products.\n\nI heard concerns about if common cold corona viruses may cause false positives - I'll discuss this in my next post involving the science of PCR as well as address \"over cycling\" (going to 50 cycles and beyond) - plus any other concerns people comment below. Thanks for your time! \n\n@vale13 @martamus @Derilajos @aaron8122 @onedeadangel\n",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1238355853662679040/activity"
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1236744383005093888",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "Its time to end this ridiculous war against any attempt to slow the COVID-19 pandemic. The most effective strategy to do that right now is to get the COVID-19 vaccine. To date over 106,000,000 Americans have been fully vaccinated. It is safe, and study after study has demonstrated that it is effective at stopping COVID-19 infection.<br /><br />106 million people! <br /><br />So what are you reasons for not getting the vaccines? I'll respond to any and all. I'm certain many of you may have legitimate reasons - but let's hear what you got. Stay well all!<br /><br /><br />*****UPDATED per conversations with <a class=\"u-url mention\" href=\"https://www.minds.com/Sierralynx456\" target=\"_blank\">@Sierralynx456</a> and others, there are reasonable concerns of safety regarding the vaccines. I will post on this topic soon. In writing, \"It is safe\" I did not mean to imply absolute no risk, but that risk was very low. I look forward to examining the specifics of this risk in a near future post. Thanks all for the open and enlightening conversations below.",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [
{
"type": "Mention",
"href": "https://www.minds.com/api/activitypub/users/604137472309342223",
"name": "@Sierralynx456"
}
],
"url": "https://www.minds.com/newsfeed/1236744383005093888",
"published": "2021-05-05T18:20:37+00:00",
"source": {
"content": "Its time to end this ridiculous war against any attempt to slow the COVID-19 pandemic. The most effective strategy to do that right now is to get the COVID-19 vaccine. To date over 106,000,000 Americans have been fully vaccinated. It is safe, and study after study has demonstrated that it is effective at stopping COVID-19 infection.\n\n106 million people! \n\nSo what are you reasons for not getting the vaccines? I'll respond to any and all. I'm certain many of you may have legitimate reasons - but let's hear what you got. Stay well all!\n\n\n*****UPDATED per conversations with @Sierralynx456 and others, there are reasonable concerns of safety regarding the vaccines. I will post on this topic soon. In writing, \"It is safe\" I did not mean to imply absolute no risk, but that risk was very low. I look forward to examining the specifics of this risk in a near future post. Thanks all for the open and enlightening conversations below.",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1236744383005093888/activity"
},
{
"type": "Announce",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/1196245514446708742/entities/urn:activity:1205687855359209472",
"attributedTo": "https://www.minds.com/api/activitypub/users/1196245514446708742",
"content": "See you might not be stupid.",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/1196245514446708742/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1205687855359209472",
"published": "2021-02-09T01:33:04+00:00",
"source": {
"content": "See you might not be stupid.",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1205731843392647168/activity",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/1196245514446708742",
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
]
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1193634552780292096",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "Hey all - a couple days ago I had an email conversation with a individual I work with who got Covid this past december - I post here for your information:<br /><br />***********************************************************************<br />My son and his fiance tested negative on Monday (they had to test to leave Upstate) so I let him come home November 27th. I even took their temps when they walked in the door. Saturday morning they immediately left, because they got word her Dad was positive and they had visited him on Thursday. Her dad ended up being hospitalized and I am very happy my son purposefully neglected to tell me that until after I was feeling better or I would’ve felt doomed. She only got cold symptoms, he had 101-102 fevers, body aches, chills and shortness of breath. About 10 days of feeling very poorly, another week of fatigue. He feels completely recovered, for age reference, he is 31. I have 3 sons, another was positive but totally asymptomatic (thank God), my youngest, his girlfriend and my husband were negative for both Covid and then the antibody test. My husband was bringing me fluids and cold packs every 2 hours, boggles the mind how the people living with me didn’t get it, but I did stay in my bedroom the whole time and we all masked if they brought me anything. We all sprayed germicidal/disinfectant on surfaces anytime the shared bathroom was used. Out of 7 of us sitting at the same dinner table, 4 were positive…two were hit hard, one was asymptomatic, one had cold symptoms.<br /><br />I had a negative test on December 1st. On December 9th, while on quarantine, I lost my smell (12 days after exposure), by December 12th I was down for the count. The day I lost my smell, I was fine in the morning, all of a sudden what I was eating at lunch didn’t taste right. Then I tried smelling peanut butter, salt and vinegar chips, oranges, even whiskey…nothing detectable. My toast burned yesterday, my husband had to yell for me to notice. It’s not terrible, you almost don’t notice its missing most of the time. I have no idea how the virus picked my stomach over my lungs, and you are right, I haven’t heard that from anyone else. If only I could use those odds on a Powerball ticket.<br /><br />...<br /><br />I was saving you from some of the gorier details but, I started having the “trots” before I lost my sense of smell (nope not back yet) but I chalked it up to worrying about my symptomatic son and if my other boy was going to start up. So maybe my stomach was weaker than my lungs at that point or the gi symptoms were just milder at the start, idk. I ended up dealing with that issue for close to two weeks, not the way I wanted to lose 7 lbs.<br />No fever, but I did have frequent bouts of chills and body aches. No sore throat, but pretty consistent headaches. I would feel worse in the morning after I got some sleep. I think a few hours without fluids would dehydrate me rapidly, so I started leaving the lights on to wake myself to drink Pedialyte during the night. I think the only thing that saved me from hospitalization is that I was able to keep liquids down.<br />I literally stayed in bed for 2 weeks, I was so tired all the time, giving myself a cough from being prone too long.<br />No phone, no tv they were too nauseating. My husband freaked out when I asked for a rosary, but it was all I could think of to get my mind distracted, lol. I was taking 8mg of Zofran as often as I could. After 5 days of that barely touching it, my doc let me try Promethazine 25 but it just made me crazy dizzy. I spent a good amount of time on the bathroom floor, luckily it’s a newly renovated bathroom and I went for the nicer tile at the time.<br /><br />I didn’t have a fever or big respiratory issues (although my son did, who gave it to me), mine were the horrible GI symptoms. I felt like vomiting 24/7 for about 10 days straight. I was using double Zofran and it was barely touching the cramping and nausea. Bad headaches, muscle aches, fatigue. I wanted to go to the hospital for IV fluids, but my primary (who I was literally calling every 2 days) told me if I was keeping down liquids to stay put. I could only go from bathroom to bedroom for two weeks. Then I got a cough for being prone so long. Last week, I was able to sit up in chairs and re-introduce some solid food. Although, I have no sense of smell back yet, my sense of taste isn’t completely gone so I am happy for that. <br /><br />I can’t even joke about Covid out loud yet and I can’t watch any news about it, I almost don’t believe I am over it, it hung around strong for so long. When I would think I was done with a symptom, it would just start up again. The second week was so much worse than the first, it is just not like any typical illness I have ever encountered, usually it is the opposite. I still get headaches, feel tired and have absolutely no desire for anything dairy. But I am a-ok with just that, I have newfound gratitude for normal nothing-going-on days.<br /><br />>>>Regarding Vitamin D<br />Yes, I have been taking 2 Vitafusion Gummies Vitamin D 3000IU along with Coq10 daily along with some Manuka Honey and Emergen C, probably since at least March. Either it did nothing or maybe it saved me from hospitalization, I don’t know.<br />***********************************************************************",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1193634552780292096",
"published": "2021-01-06T19:17:32+00:00",
"source": {
"content": "Hey all - a couple days ago I had an email conversation with a individual I work with who got Covid this past december - I post here for your information:\n\n***********************************************************************\nMy son and his fiance tested negative on Monday (they had to test to leave Upstate) so I let him come home November 27th. I even took their temps when they walked in the door. Saturday morning they immediately left, because they got word her Dad was positive and they had visited him on Thursday. Her dad ended up being hospitalized and I am very happy my son purposefully neglected to tell me that until after I was feeling better or I would’ve felt doomed. She only got cold symptoms, he had 101-102 fevers, body aches, chills and shortness of breath. About 10 days of feeling very poorly, another week of fatigue. He feels completely recovered, for age reference, he is 31. I have 3 sons, another was positive but totally asymptomatic (thank God), my youngest, his girlfriend and my husband were negative for both Covid and then the antibody test. My husband was bringing me fluids and cold packs every 2 hours, boggles the mind how the people living with me didn’t get it, but I did stay in my bedroom the whole time and we all masked if they brought me anything. We all sprayed germicidal/disinfectant on surfaces anytime the shared bathroom was used. Out of 7 of us sitting at the same dinner table, 4 were positive…two were hit hard, one was asymptomatic, one had cold symptoms.\n\nI had a negative test on December 1st. On December 9th, while on quarantine, I lost my smell (12 days after exposure), by December 12th I was down for the count. The day I lost my smell, I was fine in the morning, all of a sudden what I was eating at lunch didn’t taste right. Then I tried smelling peanut butter, salt and vinegar chips, oranges, even whiskey…nothing detectable. My toast burned yesterday, my husband had to yell for me to notice. It’s not terrible, you almost don’t notice its missing most of the time. I have no idea how the virus picked my stomach over my lungs, and you are right, I haven’t heard that from anyone else. If only I could use those odds on a Powerball ticket.\n\n...\n\nI was saving you from some of the gorier details but, I started having the “trots” before I lost my sense of smell (nope not back yet) but I chalked it up to worrying about my symptomatic son and if my other boy was going to start up. So maybe my stomach was weaker than my lungs at that point or the gi symptoms were just milder at the start, idk. I ended up dealing with that issue for close to two weeks, not the way I wanted to lose 7 lbs.\nNo fever, but I did have frequent bouts of chills and body aches. No sore throat, but pretty consistent headaches. I would feel worse in the morning after I got some sleep. I think a few hours without fluids would dehydrate me rapidly, so I started leaving the lights on to wake myself to drink Pedialyte during the night. I think the only thing that saved me from hospitalization is that I was able to keep liquids down.\nI literally stayed in bed for 2 weeks, I was so tired all the time, giving myself a cough from being prone too long.\nNo phone, no tv they were too nauseating. My husband freaked out when I asked for a rosary, but it was all I could think of to get my mind distracted, lol. I was taking 8mg of Zofran as often as I could. After 5 days of that barely touching it, my doc let me try Promethazine 25 but it just made me crazy dizzy. I spent a good amount of time on the bathroom floor, luckily it’s a newly renovated bathroom and I went for the nicer tile at the time.\n\nI didn’t have a fever or big respiratory issues (although my son did, who gave it to me), mine were the horrible GI symptoms. I felt like vomiting 24/7 for about 10 days straight. I was using double Zofran and it was barely touching the cramping and nausea. Bad headaches, muscle aches, fatigue. I wanted to go to the hospital for IV fluids, but my primary (who I was literally calling every 2 days) told me if I was keeping down liquids to stay put. I could only go from bathroom to bedroom for two weeks. Then I got a cough for being prone so long. Last week, I was able to sit up in chairs and re-introduce some solid food. Although, I have no sense of smell back yet, my sense of taste isn’t completely gone so I am happy for that. \n\nI can’t even joke about Covid out loud yet and I can’t watch any news about it, I almost don’t believe I am over it, it hung around strong for so long. When I would think I was done with a symptom, it would just start up again. The second week was so much worse than the first, it is just not like any typical illness I have ever encountered, usually it is the opposite. I still get headaches, feel tired and have absolutely no desire for anything dairy. But I am a-ok with just that, I have newfound gratitude for normal nothing-going-on days.\n\n>>>Regarding Vitamin D\nYes, I have been taking 2 Vitafusion Gummies Vitamin D 3000IU along with Coq10 daily along with some Manuka Honey and Emergen C, probably since at least March. Either it did nothing or maybe it saved me from hospitalization, I don’t know.\n***********************************************************************",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1193634552780292096/activity"
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1191614220317429760",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "Happy new years to all!!! See ya 2020!<br />",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1191614220317429760",
"published": "2021-01-01T05:29:29+00:00",
"source": {
"content": "Happy new years to all!!! See ya 2020!\n",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1191614220317429760/activity"
},
{
"type": "Announce",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/887407123175055371/entities/urn:activity:1181400321903763456",
"attributedTo": "https://www.minds.com/api/activitypub/users/887407123175055371",
"content": "<a href=\"https://petitions.whitehouse.gov/petition/pardon-julian-assange-17\" target=\"_blank\">https://petitions.whitehouse.gov/petition/pardon-julian-assange-17</a><br /><a href=\"https://www.minds.com/search?f=top&t=all&q=freeassangenow\" title=\"#freeassangenow\" class=\"u-url hashtag\" target=\"_blank\">#freeassangenow</a>",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/887407123175055371/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1181400321903763456",
"published": "2020-12-04T01:03:06+00:00",
"source": {
"content": "https://petitions.whitehouse.gov/petition/pardon-julian-assange-17\n#freeassangenow",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1185773573233197056/activity",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/887407123175055371",
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
]
},
{
"type": "Create",
"actor": "https://www.minds.com/api/activitypub/users/904583690506477569",
"object": {
"type": "Note",
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1178826732569907200",
"attributedTo": "https://www.minds.com/api/activitypub/users/904583690506477569",
"content": "Tulsi is awesome - I hope Trump is awesome too! <a href=\"https://news.google.com/articles/CAIiEBZPFIunLo6Az3UGWDiz6SQqGQgEKhAIACoHCAow77zbCjDiq8wBMOul4gY?hl=en-US&gl=US&ceid=US:en\" target=\"_blank\">https://news.google.com/articles/CAIiEBZPFIunLo6Az3UGWDiz6SQqGQgEKhAIACoHCAow77zbCjDiq8wBMOul4gY?hl=en-US&gl=US&ceid=US:en</a>",
"to": [
"https://www.w3.org/ns/activitystreams#Public"
],
"cc": [
"https://www.minds.com/api/activitypub/users/904583690506477569/followers"
],
"tag": [],
"url": "https://www.minds.com/newsfeed/1178826732569907200",
"published": "2020-11-26T22:36:34+00:00",
"source": {
"content": "Tulsi is awesome - I hope Trump is awesome too! https://news.google.com/articles/CAIiEBZPFIunLo6Az3UGWDiz6SQqGQgEKhAIACoHCAow77zbCjDiq8wBMOul4gY?hl=en-US&gl=US&ceid=US:en",
"mediaType": "text/plain"
}
},
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/entities/urn:activity:1178826732569907200/activity"
}
],
"id": "https://www.minds.com/api/activitypub/users/904583690506477569/outbox",
"partOf": "https://www.minds.com/api/activitypub/users/904583690506477569/outboxoutbox"
}